Solar Energy: the Hottest New Currency
Lewis JustEnergy-backed money could help transition humanity to a more sustainable world, both environmentally and economically.
Search results for Solar Energy
Solar Energy Day and Night
Margherita OlivoSpecial balloons able to catch the rays of the sun from above the clouds, producing clean energy day and night thanks to the help of a fuel cell.
This satellite generates and sends solar energy to Earth
Kelly van GemertThe next solar farms might be located in space, instead of on Earth. A prototype satellite by Caltech launched in January seems to be up and running, showing its capability to …
Solar Eclipse May Impact Power Supply Due to Increased Use of Solar Panels
Koert van MensvoortSolar eclipse may impact power supply due to increased use of solar panels
The Solar Biennale brings new perspectives on the energy of the sun
Ruben BaartThe sun lies at the heart of our solar system, providing life-giving light, heat and energy to Earth. The sun always gives, without asking for anything in return. In the …
Inverting the energy paradigm with Charles Eisenstein
Ruben BaartEnergy policy blah blah blah, life cycle analysis blah blah blah, energy return on energy invested, peak oil, carbon footprint, renewables, hydro, nuclear, blah blah blah blah …
Rural Energy: From Kerosine to LED
Koert van MensvoortWhile for most of us, happy blog readers, access to electricity is taken for granted, things are quite different in developing regions of the world. In India for example, over 65% …
Using Solar Powered Drones as Satellites
Ruben BaartThe experimental solar powered airplane Solar Impulse 2 succeeded its record-breaking journey over the Pacific. The Swiss team is now developing the next step of the project: solar drones.
What's solar geoeneering and why is it controversial?
James W. HurrellA report from 2021 from the National Academies of Sciences, Engineering and Medicine tackles a controversial question : Is solar geoengineering – an approach designed to cool the …
Egypt's First Solar-Powered Village
Ruben BaartThis village is powered by building-integrated solar panels and provides shelter for 350 people, putting sunlight to better use.
Solar Trees
Arnoud van den HeuvelWelsh designer Ross Lovegrove ('Captain Organic') placed several glowing Solar Trees in the streets of Vienna (October 2007). These solar powered streetlights could save cities …
Hacking Human Cells to Use Solar Power
Yunus Emre DuyarA new biotech startup seeks to hack our cells to use solar energy instead of carbon and oxygen.
The Largest Solar Power Plant in the World
Margherita OlivoA floating photovoltaic system will lie on the waters of a Japanese dam, representing the largest solar establishment in the world.
EnergyTree
Rolf CoppensThe EnergyTree is a device dedicated to monitoring your household energy use. It monitors you energy output from sockets and any device that is using electricity. It also monitors …
Solar-Powered Plane Starts its Five-Month-Long Flight Around the World
Yunus Emre DuyarSolar Impulse 2 is a Swiss project with the aim to enable long term flights using solar power.
Solar Tree That Provides Electricity
Louise HuyghebaertA tree, made with 3D printed leaves that contain solar cells.
Solar Powered Electric Cars
Daniel FragaThe sun sustains our planetary system. Its energy fuels life. And in the future, the sun will also fuel our cars. That’s the premise of Dutch startup Lightyear, a startup specialized in solar powered electric cars.
Solaris: Mind-Controlled Magnets
NextNature.netSolaris gives participants the power to control a pool of magnetic fluids with their brainwaves.
First Self Sufficient Solar-Powered Airport
Margherita OlivoThe Cochin International Airport is self-sufficient thanks to its solar power plant.
Drones and Robots Co-Work in Solar Farms
Alessia AndreottiBladeRanger might have found the ultimate solution for solar panels cleaning putting drones and robots together at work.
A Panda Shaped Solar Plant
Alejandro AlvarezChina recently built a panda shaped solar plant to get kids interested in green energy.
Smartflower Solar Device
Elle Zhan WeiPOP is an all-in-one solar energy system that hold visible benefits for humans.
Lunar Solar Power Generation
Alessia AndreottiJapanese engineers plan to turn the moon into a giant solar panel station.
The Lightest Solar Cell Ever Made
Margherita OlivoResearchers created solar cells as light as a soap bubble.
Chernobyl goes green: The ambitious plan to reclaim a nuclear disaster site
Jack CaulfieldChernobyl is famous as the site of the worst nuclear power accidents in history. The 1986 disaster has come to represent the perils of nuclear energy, much as Hiroshima represents …
BAT Flies High in the Sky to Make Energy
Francesca BarchiesiBuoyant Airborne Turbine is a giant high altitude wind turbine that brings low cost energy to remote areas and off-grid sites.
Call for projects: bring your groundbreaking creativity to tackle pressing energy issues
NextNature.netWe need to change the way we power our daily lives. Burning fossil fuels is the primary cause of climate change, yet this is still our main source of energy. Much of this energy …
First Entirely Transparent Solar Panel Could Transform our Cities
Margherita OlivoOur constant need of new, cleaner energy led a Michigan State University research group to conceive a fully transparent solar panel that could replace ordinary windows.
Driving solar with Lightyear: the world's first solar car
Ruben BaartImagine driving along in your car, powered by the same solar energy that nourishes the landscapes around it. Lightyear 0 is the world's first solar powered car, charging itself …
Energy-aware Internet-routing
Arnoud van den HeuvelData-hungry companies like Google, Microsoft and Amazon could reduce their energy consumption with 40% by rerouting data to locations where electricity prices are lowest on a …
Jewelry Harvests Energy from Veins
Yunus Emre DuyarNaomi Kizhner designed jewelry that can theoretically harvest energy from the body of the person wearing it.
Fake Grass Covered Roofs to Produce Energy
Margherita OlivoThe concept of using our rooftops to produce green, renewable energy for our houses is already very common if we look at solar panels. Now an international team of scientists is …
Will Kites Provide Wind Energy in the Future?
Megan Ray NicholsIf you’ve watched clouds roll by, you know wind moves more steadily in the upper atmosphere. Turbines just can’t reach high-altitude wind energy. Kites can!
Energy Generated from Polluted Air
Elle Zhan WeiScientists developed a device that converts polluted air into clean air while generating power.
Walking Energy Cells
Arnoud van den HeuvelRemember this one? Body heat is used to power machines in The Matrix . Nine years after the first of the trilogy came to screen, a company comes up with a body-powered-battery. In …
Bacteria that Turn CO2 into Energy
Koert van MensvoortWe’ve written earlier about man–made bacteria that eat waste & shit petrol . How about a genetically modified bacteria that can eat CO2 and excrete methane that could power …
Nano Product: Energy Belt
NextNature.netWith Energy Belt, stop treating your excess fat like a liability, and instead embrace its untapped potential. Artificial protocells in the belt mimic natural brown fat, taking …
Biomechanical Energy Harvesting
Arnoud van den HeuvelLet's face it: every time your cellphone battery runs empty you feel amputated and you quickly run back to your house to connect to a powering-adapter. Bionic Power Inc. is now …
Energy Consumption Shown on Power Plant
Koert van MensvoortInformation decoration on a city scale. Every night from the 22 to the 29 of February 2008, the vapor emissions of he Salmisaari power plant in Helsinki will be illuminated to …
Energy Saving Chandelier
Koert van MensvoortI deem you have to be over sixty to have an object with so many historical layers of media in your house. Let's analyze. We are looking at a chandelier in which the candle …
Building Grows Its Own Energy from an Algae-Farming Facade
Hanna ZoonAlgae panels make a German building completely energy independent.
Solar-Powered Donkeys to Stay Online
Margherita OlivoTurkish shepherds are installing solar panels on their donkeys to stay connected.
EcoBot III: a Robot that Produces Energy Fueled by Organic Matter
Alessia AndreottiThere are robots that look like people, and then there are robots, like the Ecobot III, that look nothing like humans but have our same biological needs: they have to eat, digest …
The Future of Solar Power? Snail Teeth!
Marco van BeersThe gumboot chiton snail produces the hardest biomineral known on earth - and it may hold the secret to better nanotechnology.
New Robot Turns Poo into Energy
Allison GuyThough disgusting, sewage is an abundant, nutrient-rich resource. Researchers at the University of West England have taken advantage of this fact by creating a robot that turns …
How a Hummingbird Creates Green Energy
Michelle GuenneA start-up company build a wind turbine inspired by the hummingbird.
The path towards solar democracy with Marjan van Aubel
Meike SchipperSolar cells are often considered an eyesore, used for their sustainability yet not for their beauty. Installed on roofs or in solar parks, they take up precious space. Well that’s …
Why we need to get better at predicting space weather
Koert van MensvoortThe Sun is the most important source of energy for sustaining life on Earth, but it gives us a lot more than just light and heat. It also gives us solar storms.
Floating Green Power
Megan Ray NicholsOffshore renewable energy resources, such as floating solar arrays, have begun to pop up around the world.
Gathering Electricity from the Atmosphere
Stephen Perry"Atmospheric energy" has the power to revolutionize the production of electricity.
Marjan van Aubel wins ECO Coin Award
Next Nature DevEach year we search the globe for people and projects that have outstandingly contributed to make this planet a more sustainable place and honor them with our ECO Coin Award . We …
POND is a symphony of lights and water
Nellie FriedrichHave you ever gone a day without water? Most likely you have experienced low energy levels or fatigue after a few couple of hours. Water gives us energy. More than that, water is …
Next Nature and the Curse of Oil
Tere VadénThe next step is to embrace and celebrate how cultural artifacts are escaping control, becoming autonomous, and forming the “next nature”.
Imported African Sun: Coming Soon
Alejandro AlvarezThe recently opened Noor solar power plant is now the biggest in the world. It will power Morocco and if everything goes as planned imported solar energy can be a reality too.
Making Power Stations Part of the Landscape
Margherita OlivoCan we have pretty power stations? The design of power stations is becoming more appealing.
Making Seawater into Clean Fuel
Jack CaulfieldScientists have been hard at work searching for renewable energy sources. Now, a new breakthrough: the ability to produce hydrogen fuel from seawater.
Furniture futures
Nellie FriedrichWondering how next natural furniture may change your way of life? Will we feed our lamps? Grow chairs? Talk with our tables?
An Ecstatic Dialogue with Richard Doyle
Jason SilvaWhen techno–optimist and fellow at the Hybrid Reality Institute , Jason Silva, meets with Richard Doyle, author of Darwin's Pharmacy: Sex, Plants and the Evolution of the …
Jobs for Facilitators - Robots at Work #3
Mathilde NakkenThis is post number three of our serie 'Robots at Work'. In this episode we present you five jobs for facilitators, the ones who love to work with technology.
Electric cars might not yet be green, but we should buy them anyway
Ranald BoydellTransforming the way we travel is an essential part of tackling the climate crisis. The transport sector contributes about 20% of global carbon emissions . In the UK the figure is …
The return of trade: Blockchain technology is enabling trade to make a fierce comeback
Koen WeselBefore money came into existence, trading was all we knew. Farmers in China traded their spades for food and other goods, and this continued up until a point where most spades …
Interview: Pauline Van Dongen, Designer Merging Fashion and Technology
Margherita OlivoDutch fashion designer specialized in wearable technology, Pauline van Dongen researches the human body in relation to its surroundings.
A Floating Gym in Paris
Ruben BaartThis floating gym harnesses human energy to sail down the Seine River in Paris.
In conversation with Teresa van Dongen, biodesigner exploring natural forms of artificial light
Kelly van GemertThere was a time when flipping the switch, and seeing a glass bulb light up, was magical to anyone in the world. Today, the presence of a light switch in a room, is something …
Why electric cars should be allowed to drive faster
Koert van MensvoortIn response to the nitrogen crisis, the Dutch cabinet is planning to reduce the speed limit during the day to 100 kph. In itself a sensible decision. But it is strange that this …
Social Networking with Plants
Ties van de WerffUsing energy is not a social activity. Every electrical device we use has its own carbon “foorpint” which, in excess, can harm other living beings. How and to what extent you’ve …
Fake Leaf is Twice as Efficient as the Real Thing
Allison GuyImproving on photosynthesis has long been a dream for scientists. The so-called artificial leaf – which wouldn't necessarily look like one – would run on only solar energy and …
Body hair helps animals stay clean – and could inspire self-cleaning technologies
David HuWatch a fly land on the kitchen table, and the first thing it does is clean itself, very, very carefully. Although we can’t see it, the animal’s surface is covered with dust, …
Ermi van Oers wants to bring living light to your living room
Jack CaulfieldThe Living Light harnesses plant energy to provide light. We spoke to its designer, Ermi van Oers, to find out more about the unique product.
We could power households from the scraps in our food waste bins
Ananya MukherjeeImagine if you could power your kettle using the energy generated from the vegetable cuttings quietly breaking down in your kitchen’s compost bin. That reality might not be so far …
Cooling buildings with ultra-white paint
Andrew ParnellFrom icy tundras to billowing clouds, the colour white crops up repeatedly in our planet’s palette. This colour provides a natural way for light from the sun to reflect back from …
Billionaire space race: the ultimate symbol of capitalism's obsession with growth
Tim JacksonMars ain’t the kind of place to raise your kids, laments the Rocket Man in Elton John’s timeless classic. In fact, it’s cold as hell. But that doesn’t seem to worry a new …
How technology will help us adapt to climate change
Ruben BaartClimate change will transform how we live, but these tech and policy experts see reason for optimism
A Stroll Through the Bubbles of Chemicals and Men
Etienne TurpinA stunning pre-history of the anthropocene
Happy New Green 2017!
Alejandro AlvarezA bright green is the color of 2017, a perfect choice if we take into account some of the positive developments in renewables reached in 2016.
How this self-sustainable microhome may change the future of housing
Belen MunozLooking for a self-sustainable mobile microhome? Ecocapsule got you covered. This cute-as-pie capsule pod allows you to live completely off the grid in a low-energy, mobile …
Growth is not the problem, but the solution
Ruben BaartIf we want to bring down global CO2 emissions to zero, we will need technological innovation and massive infrastructure projects.
Pyramid of Technology: How technology becomes nature in seven steps
Koert van MensvoortHow technology becomes nature in seven steps
Facebook's Internet Drone Unveiled
Yunus Emre DuyarFacebook introduced its solar-powered drone project aimed to provide internet access to rural areas.
Welcome to the Hearth of the Sun
Alessia AndreottiSolarium, a video installation by NASA’s Solar Dynamics Observatory (SDO), puts visitors in the hearth of the sun.
ReGen, the Autarchic Off-Grid Village
Margherita OlivoUtopian off-grid ReGen Village produces all of its own food and energy is being implemented in Almere.
The future infrastructure of the blockchain might be green and humane
Koen WeselThe connection we share through the Internet has laid the foundation for a whole new digital infrastructure, in which blockchain technology is heralded by many believers for being …
How cities are cutting out cars
Vanessa Bates RamirezIt’s common consensus in the tech industry that the days of cars as we know them—powered by gas, driven by humans, and individually owned by all who want and can afford one—are …
How bacteria can recover precious metals from EV batteries
Sebastien FarnaudThere are more than 1.4 billion cars in the world today, and that number could double by 2036 . If all those cars burn petrol or diesel, the climate consequences will be dire. …
The Next Nature gift guide 2021
Next Nature DevAs winter arrives, so does the season of giving. Good gift giving is an art and can be quite the endeavor at times. But don’t worry, Next Nature is here to help! We present to you …
Nature Loves Technology
Next Nature DevWe interviewed William Myers and Emma van der Leest, curators of Nature Loves Technology, our exhibition at Floriade 2022
Afterlife for Atheists
Lisa van der VoortWhere religions promise their believers a life after death and cryonics also needs a kind of belief in future technological development, designers James Auger and Jimmy Loizeau …
Snapshots from the Next Nature Lab
Koert van MensvoortLast week, the young and talented designers of the Next Nature lab at the Eindhoven University of Technology presented their end of term works in an internal exhibition. There are …
Bionic Plants
Alessia AndreottiScientists designed a way to improve the efficiency of plants light harvesting during the photosynthesis, using nanotechnology.
eTree – Electric Gardening
Alessia AndreottiAn eco-sculpture that looks like a tree. Its foliage is made of solar panels able to produce energy.
Vertical Farms Growing In Giant Trees
Francesca BarchiesiUrban Skyfarm is a giant tree-shaped farm system for environmental improvement in food production and distribution.
France Says Adieu to Plastic Tableware
Monika KozubFirst they banned plastic bags all over the country in July, now they released a new regulation: starting from 2020, no plastic cups, plates and cutlery can be distributed in France.
World's "Coolest" Hotel
Ruben BaartSweden's new Icehotel 365 uses solar cooling to stay open all year.
The End of Air-Conditioning
Elle Zhan WeiNew heat-reflective material signs the end of air-conditioning use.
Beyond biomimicry: a new urgency
William MyersDesigners face an unprecedented urgency to alter their methods and reprioritize their goals to address the accelerating degradation of the environment. This new …
An introduction to biomimicry
Janine BenyusThe first time I explained biomimicry to a stranger was not in a talk or a workshop but in a big-box bookstore just after Biomimicry: Innovation Inspired by Nature had come out. I …
We’re all radioactive – life isn't possible without it
Marit BeerseMost radiation is natural and life on Earth wouldn’t be possible without it.
Dubai will soon house the world's largest artificial coral reef
Kelly van GemertA floating sustainable city where humans can live, work and study while supporting aquatic ecosystems. Soon this will become a reality in Dubai, as sustainable real estate company …
1962 Oil Company Advertisement boasts about ability to Melt Glaciers
Koert van MensvoortIf this gasoline advertisement would be submitted to our infotizement contest , we would probably dismiss it for being too cynical and far fetched. Nonetheless, this ad was …
Nanotech Diatoms
Allison GuyNo, those aren't plastic trinkets or beads from a craft store. They're diatoms, a group of single-celled algae, and unlike almost all of our current technologies, they can rapidly …
"Smart Highways" to Power Streetlights and Electric Cars
Allison GuyRoads are a ubiquitous, even defining aspect of our urban and suburban spaces. In the United States alone, parking lots and roads cover 16,000 square kilometers. So why must roads …
Urban Heat Causes Trees to Grow Faster
JenniferThe high temperatures of urban environments causes trees to grow faster in the city than in rural areas. Researchers at Columbia's Earth Institute have discovered this by planting …
Innovative Nostalgia
Koert van MensvoortWe humans simply feel more comfortable with technological change when it comes in a familiar form that refers to an existing and accepted object, habit, value, tradition or intuition.
Interview: Rachel Armstrong, Innovative Scientist Who Wants to Grow Architecture
Alessia AndreottiRachel Armstrong discusses living buildings, Venice's foundations, millennial nature and how to improve our future.
Shape-Shifting House Acts like a Flower
Jelle LangeraapImagine your home adapting itself to seasonal, meteorological and even astronomical conditions by changing its shape. D*Dynamic is based on the discovery of mathematician Henry …
Pixel Space
Lotte BiesheuvelIf the moon were only one pixel: a scale model of the solar system that shows how big our milky way actually is.
The origin of the LED lamp
Huub EhlhardtFor thousands of years people used oil lamps and candles to illuminate their homes during the hours of darkness. Neither produced much light and both were inconvenient in use as …
Humans could recolonize Earth after mass extinctions with ectogenesis
Matthew EdwardsLately it seems that every movie, book and video game we see is about future apocalypses. Science articles are also painting a grim future for Earth and its inhabitants. If it’s …
All aboard the world's first hydrogen passenger train!
Selin KirAs the world is trying to keep carbon emissions under control, humans are also looking for viable carbon-neutral transportation options. The people from French rolling stock …
Recreation in NextNature
Arnoud van den Heuvel(Not a tourist-pic from North Korea) In January this year, at the World Future Energy Summit in Abu Dhabi, Prince Willem-Alexander of the Netherlands said: "(...) My wife and I …
Sunflowers – electric gardening
Koert van MensvoortA retail lot in Austin, Texas recently sprouted a field of solar photovoltaic sunflowers that soak up the sun’s rays to provide shade while generating a steady stream of …
Antenna roofgarden
Koert van MensvoortDon't ask me what the purpose is of having your roof crowded with antennas. Solar energy roof-gardens I could understand, but antenna roof-gardens just seem hopelessly old …
There’s Plenty of Room at the Bottom
Hendrik-Jan GrievinkSo you’re triggered by our call for products and now you’re considering to send in one, two or maybe three of your brilliant products for the Nano Supermarket? Good. Or – and this …
Self–Repairing Architecture
Rachel ArmstrongAll buildings today have something in common: They are made using Victorian technologies. This involves blueprints, industrial manufacturing and construction using teams of …
NANO Supermarket Jury Report 2012
NextNature.netAfter the successful introduction of the NANO Supermarket in 2010 it became even more clear that the contest and the presented results produced discussions and many challenges to …
Clothes that Turn Heat into Electricity
Allison GuyWith rising energy costs and our growing arsenal of iPads, smart phones, and wearable monitors, we're always on the lookout for new ways to power our devices. Perpetua Power , an …
The Bionic Kangaroo
Alessia AndreottiThe BionicKangaroo technologically reproducesthe unique way a kangaroo moves.
What’s the Point If We Can’t Have Fun?
David GraeberSince Darwin we tend to look at the biological world exclusively in economical terms. The idea that monkey's, frogs, or even ants do more than simply propagate, doesn't find much acceptance among scientists. And yet, even crayfishes at times seem to displace objects just for fun.
Our Bodies, Our Fuel
Adriene LillyThis piece from Ars Technica details the breadth in the variety of energy sources emitting from our every day interactions.
53 Shades of Blue
Ruben BaartAn artist installed a sculpture on the main street of Ljubljana, Slovenia, that measures the blueness of the sky.
Future Architecture: Digesting Walls
Mathilde NakkenThe University of West England is developing living bricks, turning your walls into a digesting organism.
Turning Leaves into Batteries
Margherita OlivoOther than decompose and give nutrition to the soil, leaves can be used to store energy, becoming the raw material of batteries.
Old Cellphones to Fight Deforestation
Margherita OlivoA Californian engineer is using old cellphones and solar panels to save the rainforest ecosystem against deforestation.
How Much Carbon Do Your Clicks Cost?
Jack CaulfieldHow much carbon does a Youtube video burn? Greenpeace's #ClickClean initiative calls on big tech companies, like Google, to use renewable energy sources.
Interview: Lining Yao, Interaction Designer and Maker of Novel Materials
Alessia AndreottiWe recently interviewed Lining Yao, Chinese interaction designer who uses organic materials as a technology that brings us back to nature.
Otra Nation: Make Walls Great Again
Elle Zhan WeiThis group of 14 designers, engineers, builders and architects make a proposal of a wall for Trump's ambitious project.
Celebrating Dutch Water Protection:
Last Weeks to See 'Gates of Light'
Kelly van Gemert
If you are in The Netherlands you can explore the latest art project by Studio Roosegaarde and discover the iconic, yet historical value of the Closing Dike.
Next Generation: Producing glass from ashes with Benedikt Peirotén
Marit BeerseBenedikt Peirotén has started a project called ‘From the Ashes’ proposing using waste streams to replace the energy-intensive ingredients in glass.
Why Borghildur Indriðadóttir wishes to perform on the Moon
Kelly van GemertWhat is the meaning of art on the moon? Artist on the Moon is the latest project from Icelandic visual artist Borghildur Indriðadóttir , who aims to perform for the stars and …
Power Aware Cord
Dr NaturalThe Power Aware Cord transports electrical power while simultaneously visualizing energy usage. Electrical transfer is represented through glowing pulses, flow, and intensity of …
Simulacra and Simulations
The simulacrum is never that which conceals the truth--it is the truth which conceals that there is none. The simulacrum is true. -Ecclesiastes If we were able to take as the …
Bacteria That Eat Waste & Shit Petrol
Koert van MensvoortEnergy problem? Why not genetically alter bacteria to have them provide 'renewable petroleum'. Crude oil is only a few molecular stages removed from the acids normally excreted by …
Craig Venter – Catalyst of evolution
Koert van MensvoortIf the six hour crash course on synthetic genomics is a bit too much for you, there is always a more snappy TED lecture in which Craig Venter ponders on whether we can create new …
The Playboy Interview
In 1961, the name of Marshall McLuhan was unknown to everyone but his English students at the University of Toronto – and a coterie of academic admirers who followed his abstruse …
FluDOC – Glowing Bacteria Show if You Have Influenza
Koert van MensvoortBacteria are traditionally perceived as infectious and unhealthy, but that is about to change. This week designer Jan van der Asdonk graduated from the Next Nature Lab at the TU/e …
Next Nature Introduction
Bruce SterlingThis project - the Next Nature Network - is about Nature's brand image. One might surmise that "Nature," being 100 percent all-natural, can't have any brand image. The facts …
Our Heart as a Power Plant
Marco van BeersNanowire generators could one day lead to medical devices powered by the patient's own heart. A tiny, nearly invisible nanowire can convert the energy of pulsing, flexing muscles …
Apes Like Cooked Food, and What that Means for Human Evolution
Allison GuyHumans are the only species on earth that cooks its food. Not only do we cook our food, but we usually find the flavor of cooked foods preferable to the raw version. Compare the …
![Visual of Manko & The Earth [#12]](https://nextnature.net/media/pages/magazine/story/2011/manko-the-earth-12/b1f1cf8f03-1602632753/manko12-868x486.jpg)
Manko & The Earth [#12]
Aston RevolaZero: 'Where to begin? We've had many discussions in our Lab about the future of the children. The plan was simple: to raise the kids to the physical age to be 'frozen' in. Then, …
Latro Algae Lamp
Koert van MensvoortAs advances in nanotechnology bring us increasingly energy efficient products, plant life such as algae could become attractive sources for tapping energy. The Latro lamp by …
NANO Supermarket at Lowlands Festival
Koert van MensvoortThis weekend some of our sustainable, energy related, NANO Supermarket products are exhibited at the lustrous Lowlands popfestival . Come visit us at the Llowlab to charge your …
Turning Wind Farms into Seaweed Farms
Allison GuyClosed to commercial shipping and fishing, offshore wind farms aren't put to much use besides generating clean energy. Ecofys , a Dutch sustainable consulting company, hopes to …
Offshore Wind Farms Generate Their Own Microclimates
Patty ChanAs we strive to milk all available energy from nature, we not only harvest but alter our surroundings in the process. By mixing the warm sea air with cooler air above, offshore …
Yes, Naturally
Ine GeversThe introductory essay from the Yes, Naturally book - available in our store!
GMO Trees to Simplify Paper Production
Alessia AndreottiResearchers engineered poplar trees for an easier production of paper and biofuels.
Bioprinting in the Kitchen of the Future
Alessia AndreottiCultivator is speculative design project on how bioprinting could find its way into the kitchen of the future.
Wireless Controlled Mouse, the Animal!
Alessia AndreottiA remote-controlled LED chip can make a mouse walk in circles.
A Cryptocurrency Helping to Cure Cancer
Lewis JustPart two of a ten part series exploring the design of an invisible technology: money.
Guerilla Gardening in Paris
Ruben BaartParis passed a new law that not only allows locals to plant their own urban garden around the city, but also encourages them in doing so.
Israeli Tech Turns Any Road Electric
Alessia AndreottiElectRoad developed a unique technology that powers the vehicle wirelessly from the road while driving.
The Next Nature Sneaker Series
Mathilde NakkenWe present for the real sneaker heads amongst us, six new futuristic pieces of footwear. Going from pineapple leather to self lacing 'Back to the Future' Nikes.
“Next Tokyo” City Plan Unveiled
Ruben BaartA proposal for a residential skyscraper in Tokyo Bay as part of “Next Tokyo”, takes into account the recurrent threats of rising sea levels, seismic activity and typhoons.
The Scandinavian Winds Power Your Internet
Alejandro AlvarezWe may be still far away from pollution-free Internet browsing, but at least the next time you send an e-mail you can feel relief at the thought that the strong arctic winds of Scandinavia are keeping the Google servers cool and running.
PC Problems? Better Call a Witch!
Margherita OlivoMeet the witch who casts viruses out of computers with magic.
Iceland is mourning a dead glacier
Rupert ReadDeath certificates and commemorative plaques aren’t something you’d normally associate with a glacier. But that is exactly how Iceland recently mourned the loss of 700-year-old …
3 ways Virtual Reality is revolutionizing teaching
John PickavanceYou’ve probably heard how Virtual Reality (VR) is going to change everything: the way we work, the way we live, the way we play. Still, for every truly transformative technology, …
How fungi can help create a green construction industry
Ian FletcherThe world of fungi has attracted a lot of interest and seems to be becoming very fashionable of late. A new exhibition at Somerset House in London, for example, is dedicated to …
Blocking the sun with dust
Vanessa Bates RamirezIn the past few years, scientists have hatched some pretty crazy-sounding schemes in the name of protecting Earth and its inhabitants. From building an underwater wall 120 …
This book explains why cooking food was essential to human evolution
Ruben BaartA must-read to the Next Nature fan: Catching Fire: How Cooking Made Us Human (2009). Written by British primatologist Richard Wrangham, the author shares his hypothesis that …
Can microbes communicate with alien species?
Ruben BaartAre we alone in the universe? The famous Seti (Search for Extraterrestrial Intelligence) programme has been trying to answer this question since 1959. American astronomer Carl …
Nurturing architecture
Ruben BaartThe way we currently build is not sustainable. We will have to develop a sustainable living environment that matches our human needs, intuitions and potential.
Enter the symbiocene
Glenn AlbrechtWhat if we would use the idea of symbiosis as the basis for the next period of Earth’s history?
Featherless Chicken
Koert van MensvoortBehold the featherless chicken, created by Scientists at the genetics faculty at the Rehovot Agronomy Institute near Tel Aviv, Israel. The idea behind the development of this …
Green Electricity
Hendrik-Jan GrievinkElectricity itself is a natural phenomena, but as regular AC/DC currency it becomes a commoddity. But Green Electricity is a strange thing. You pay more money for your electricity …
Humans to Blame for Global Warming
Koert van MensvoortGlobal warming is "very likely" a human-caused problem that will last for centuries and require concerted international action to reduce its potentially devastating impacts, a …
MDI Air Car
Arnoud van den HeuvelWill the oil-driven car grow extinct in the decades to come? Guy Negre (Fr) thinks so, for he invented: THE CLEAN GREEN DRIVING MACHINE! Utopia is near; this (toy ) car runs on …
Economy is ecology
Koert van MensvoortNature is itself a free market system. A rain forest is an unplanned economy, as is a coral reef. The difference between an economy that sorts the information and energy in …
Hail Control Gun
Arnoud van den HeuvelA single hail storm can destroy the year's harvest. For over 25 years, this gun has been used by vine and fruit growers in France, Spain, Austria and Belgium for one purpose: …
Search Engine
Arnoud van den Heuvel"Google has stationed approximately a million computers worldwide to be able to process the 40 billion searches per month. One search request uses as much energy as a low-energy …
BioStream
Arnoud van den HeuvelA renewable energy technology company in Australia designed this power generation system inspired by the shape of the tailfins of sharks, tuna and mackerel. The currents on the …
Computer versus bacteria
ReneeAre bacteria faster than a computer? According a group of biological engineers they are. The scientists have done a research in which they have used the well-known bacteria …
Five strategies of Biomimicmarketing
Koert van MensvoortGreen electricity, Organic Shampoo, Jaguar convertibles, Red Bull, Bio Beef, Alligator gardening tools, Camel cigarettes and Puma sneakers. Once you develop an eye for it, it is …
Live with Micro-Algae
c.sallustroThe Eco Pod is a experimental design proposal towards the production of clean and renewable energy, which should operate in old, abandoned buildings. Pending an eventual recovery, …
Strategy #4: Brand It ‘Eco Friendly’
Koert van MensvoortThe products in the fourth category don’t necessarily provide the consumer with a natural feeling. Their biomimicmarketing revolves around the claim to be ‘friendly towards …
Sunlight-shaped Furniture
Arnoud van den HeuvelAustrian designers Katharina Mischer and Thomas Traxler have created a solar powered machine that makes arrays of furnishings that vary based on how much sunlight it receives over …
Water Shows When the Heat is On
Koert van MensvoortDesigner Carlijn Compen upgraded her watertap with some LED's that shift color along with the heat of the water. A simple yet effective example of information decoration that will …
Meet the Cellphone that drinks Coke
Koert van MensvoortChinese designer Daizi Zheng created a conceptual mobile phone for Nokia that could be powered by cola. The idea is the phone could run on a battery that uses enzymes to generate …
Miniature Sensor Network for the Office
Koert van Mensvoort"Have you seen my stapler? No, but just look it up on Google home office maps ." CSIRO Researchers have developed miniature sensors that track lab equipment, coffee mugs and …
Toy Emissions
Koert van MensvoortYou know the HeHe collective from their laser projection on a power plant emission cloud . But did you know these folks have a real emission clouds fetish going on? In this …
Animal-Free Meat Could Put a Hold on Global Warming
Koert van MensvoortGrowing meat in the lab, rather than slaughtering animals, could become a viable alternative for people who want to cut the environmental impact of their food consumption, but …
Bugged Bugs
Stefan FinckenSome of you might remember the Next Nature article by Rolf Coppens called Withus Oragainstus . Since then there have been occasional newsreports on cyborg insects. For instance …
Evolutionary Janitors
Allison GuyWe normally think of polluted water as the source of disease, not the cure for it. The Gowanus Canal in Brooklyn, affectionately known as the Super Fun Superfund , is one of the …
Manufactured Rainbows
Bastiaan EkelerWhy wait for old nature to give us rainbows when we have so many ways of making our own? The image above shows solar-powered installation that uses recycled rainwater to create …
The Story of our Food
Maartje SomersEvery time we eat a piece of food, we take a bite out of the world. All these small bites tell a dozen stories. A carton of eggs presents the story of contented hens, a bottle of …
Bioinspired Robojelly Can Swim Forever
JenniferScientists have developed a biomimetic robot that will be able to swim forever, since its artificial muscles are powered by water. And since Robojelly lives underwater, it will …
Growing Plants in the Dark
Allison GuyWhile sunlight contains all colors, the dominant type of chlorophyll in plants only needs purple light to function. This simple fact has big implications for the future of …
Power, Water and Shelter from Giant Mushrooms?
Tim HuibertsIn his (fictional!) documentary, designer and artist Tobias Revell sketches the city of New Mumbai powered by giant mushrooms. These genetically-engineered fungal organisms …
To Generate Electricity, Just Tap on this Virus
Allison GuyIs your friend impatiently tapping on her phone, or is she just charging the battery? Researchers at the Berkeley Lab have produced the first virus-powered generator that runs off …
Will Eugenics Become an Acceptable Strategy to Avoid Climate Change?
Koert van MensvoortClimate change is one of the biggest challenges of today and various scenarios, ranging from artificial trees , pollution trading , co2 capturing to geo-engineering, have been …
Free Electricity from the Technosphere
Teije OudshoornScientists learn how to harvest electricity from radio waves.
Moss Table Powers Its Own Lamp
Allison GuyWhen moss photosynthesize, they release nutritious fats, carbs and proteins into their roots to feed colonies of helpful, symbiotic bacteria. In the process of breaking down these …
NANO Supermarket 2014 Call for Products
NextNature.netSubmit your speculative product to the NANO Supermarket and win 2500 euro.
Q&A with CEO of In Vitro Meat Company "Modern Meadow"
Stephen PerryExcerpts from the Rebbit AMA with Andras Forgacs, founder of a company that manufactures in vitro meat.
"Soylent" Liquid Meals Will Save the World
Alice FumeyCan a meal replacer save us money, time, and maybe even save the world?
In Vitro Recipe #3: Magic Meatballs
NextNature.netMagic meatballs playfully familiarize children with the concept of in vitro meat.
Three Points in Support of In Vitro Meat
Alessia AndreottiThe top three aspects why people should support cultured meat.
Transportations Of The Future
Francesca BarchiesiA selection of nine enthralling and striking concepts of future way of transportation.
Wearing Technology Under the Skin
Alessia AndreottiUnderSkin is a device that would be implanted beneath the skin on your hand and charge off your body’s energy.
Changing your Mood on Demand with Brain-Altering Wearable Technology
Alessia AndreottiThync, is a new brain-altering wearable technology that promises to “shift your state of mind and conquer life” by allowing its users to change their mood whenever they need it.
NANO Supermarket 100 m2 Pop-Up Store
NextNature.netOur lustrous NANO Supermarket opened a 100m2 pop-up store in Stavanger, Norway.
Scientists could Reveal a Parallel Universe
Yunus Emre DuyarLarge Hadron Collider in Geneva will attempt to detect or create mini black holes, to reveal a new universe.
Seaweed Farms to Solve the Problem of Ocean Acidification
Margherita OlivoBy burning fossil fuels we are responsible for the increase of carbon dioxide in the Earth's atmosphere. Aside from raising temperatures globally, this is also affecting our …
The Golden Quarter
Michael HanlonSome of our greatest cultural and technological achievements took place between 1945 and 1971. Why has progress stalled?
Cockroach Milk: the Next Superfood?
Monika KozubA recent research reveals that the next extra nutritious ingredient may be the liquid produced by cockrach mothers to feed their offsprings. Are you willing to try it?
I Want Wings!!!!!!!!!!!!!!
Nicholas CarrRead Nicholas Carr's essay on the transhumanist dream of having wings.
Hyperloop Set to Change Mass Transit
Megan Ray NicholsThe Hyperloop is a future transportation means that is safer, faster, and cheaper than current forms of mass transit.
Japan Is Ready to Pay Bills with Bitcoins
Alejandro AlvarezJapan is the first country to accept the bitcoins as payment method for basic services.
Photoshop Hacks Become In Real Life Art
Nadine RoestenburgUV Production House reflects on popular online platforms for maker culture.
Bionic Leaf Helps Vegetables to Grow
Julie ReindlBionic leaf fertilizes crops to make them weigh 150 percent more
ECO Coin Award Interviews: Ritsert Mans
Jack CaulfieldWe asked Ritsert Mans, our second ECO coin award nominee about his bike, the technology that fuels it and his hopes for the future.
Sustainable Flying with Electric Planes
Elle Zhan WeiGerman company revealed fastest electric plane.
Tattooing Fruits and Veggies with Lasers
Ruben BaartEco-friendly lasers might soon replace stick-on labels on fruits and veggies.
Wind Turbines Threatens Birdlife
Elle Zhan WeiA wind farm in Scotland is on hold because of its lethal killing power towards seabirds.
Earth is so strongly impacted by its human inhabitants that it's now a “hybrid planet”
Jack CaulfieldHumanity has for a long time considered itself the most important species on the planet. We are quite happy to share the world with other species, but we think we know who's in …
The future of the ECO Coin
Koen WeselHow can we design a cryptocurrency for the better of humanity and ecology? In this last chapter of the crypto deep dive series , we will dissect two kinds of blockchain …
Three scenarios for the future of farming
Kelly van GemertAgriculture may be one of the oldest of our technologies. Over time it has developed, changed, revolutionized, industrialized - or simply put, it has evolved . Today’s farms are …
Lucas Foglia's photography explores the uneasy relationship between humans and nature
Laura MalloneeThere’s no place on earth untouched by human activity: This was clear as Lucas Foglia whizzed across the vast, white expanse of Alaska's Juneau Ice Field last summer. He was …
The New Technology in Agriculture: Trees
Jack CaulfieldNew technologies are changing the landscape, but the latest trend reshaping rural environments and agriculture is agroforestry: the art of planting trees.
4 visions about the future of public transportation
Marcus EnochThe way people get around is starting to change, and as a professor of transport strategy I do rather wonder if the modes of transport we use today will still be around by the …
Why not all buildings have sustainable green roofs
Michael HardmanRooftops covered with grass, vegetable gardens and lush foliage are now a common sight in many cities around the world. More and more private companies and city authorities are …
Next Generation: Hearing the first breath of Earth with Dora Lionstone
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Generation: Simulating textile ecosystems with Scarlett Yang
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Future cities: why we need to reimagine the look of urban landscapes
Ruben BaartIn imagining future urban landsapes, we need to answer questions about what can be sustained and what cannot, where cities can be located and where they cannot.
Gear up for our VR timemachine!
Next Nature DevTravel to big future in our VR timemachine at the Evoluon in Eindhoven
That modernist dream of the house as butler is not going to happen
Helmke van GeelLooking at evolution, we see that there’s always a next nature. Nature changes along with us. How will that influence our way of life in the future?
Meet the lungs of the sea: phytoplankton
Abigail McQuatters-GollopPhytoplankton are microscopic algae living throughout the ocean’s surface waters. They can’t swim and are at the mercy of the currents and tides. Despite their small size, …
To save forests, researchers are hooking trees up to Twitter (again)
Ruben BaartIn July 2018, a century-old red oak went live on Twitter. The account @awitnesstree , tweeting from the Harvard Forest in Petersham, Massachusetts, introduces itself in its bio: …
Working with microbes to clean up electronic waste
Sebastien FarnaudIf you were to stack up all the electronic waste produced annually around the world it would weigh as much as all the commercial aircrafts ever produced, or 5,000 Eiffel towers. …
Building with biocement
Marit BeerseUsing the waste streams from the chemical industry and urine to make biocement.
Next Generation: Sensing the critical zone with Menno Brouwer
Kelly van GemertThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Understanding the ocean's metabolism
Marit BeerseScientists have discovered the effect of sunscreen on corals. We need to understand our impact on the world to understand its problems.
The Limits and Beyond: A report about the future
Marit BeerseIn 1972, the Club of Rome published The Limits to Growth, a report about the future of the world. They described the limits of the world’s resources and what it is capable of …
Next Generation: Writing a design manifesto with Pleun Wilting
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
From Megabytes to CO2
Marit BeerseThijs Biersteker has designed an art installation that shows the carbon dioxide emission of the internet.
Fashion brand Ganni grew leather with bacteria
Kelly van GemertDanish fashion brand Ganni proposed a post-leather future: they grew imitation leather with bacteria.
Paco Rabanne's AI-designed perfume can connect with your phone while making you smell sexier
Selin KirPaco Rabanne already positioned himself as a cutting-edge designer by establishing his reputation as one of the trailblazers during the space age movement of the 1960s. With his …
MyPowerbank hacks bicycles so the homeless can juice up their phones
Kelly van GemertLuke Talbot has developed a solution to assist people experiencing homelessness in charging their phones for free by hacking rental bicycles.
20k human chip
Arnoud van den HeuvelAAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes …
24 hours economy
Rolf CoppensCould the biggest, most successful discount store in the world really meet your every need? Twenty-four hours a day? That's what the TV spots are saying. Really living there. …
Entry 2006 exhibition opened
Koert van MensvoortToday the Entry 2006 exhibition opened in the coalwashe building, Zollverein. For 100 days 'perspectives and visions in design' with over 300 exhibits from more than 20 countries …
Google Maps Mars
Dr NaturalGoogle has added it's first map of a Solar Planet to the google maps. The map of Mars provides detailed information of its mountains, craters, plaines and more (including …
Would You Like a Bouquet of Nanoflowers?
Koert van MensvoortThese crystalline 'nanoflowers' were developed by Cambridge University PhD student Ghim Wei Ho. The nanostructures of silicon carbide are grown from droplets of gallium on a …
Bonsai tree table
Koert van MensvoortSomehow next nature seems to reveal itself through furniture. Earlier we've featured the treetrunk bench , the bone chair , the folding chair , sketch furniture and how to grow a …
Digizerk
Arnoud van den HeuvelHenk Rozema displaying his invention (2006), the digital tombstone "Digizerk". It was only a question of time that global digitalization would be introduced on cemeteries. The …
Next Nature Interview
For the Venezuelan Magazine Platanoverde , Gabriela Valdivieso y Lope Gutiarrez-Ruiz interviewed artist/scientist Koert van Mensvoort and discussed some of the idea's behind Next …
Sleeping beauty
Rolf CoppensWhere there is light, there is life. When you switch on the lamp, it provides you with light. You provide it with the generating power it needs togrow. Similar to living …
Tulip Island - Design a Polder
Arnoud van den HeuvelA proposal to gain 600.000 m 2 of land near the Dutch coast recently came from the CDA (Dutch Christian-Democratic political party). The idea is to create a tulip-shaped island …
Fatigue Risk Management
Rolf Coppens"Through individual assessments, employee training and EnergyPods, MetroNaps can help you improve the safety of your workplace, the health of your employees and the productivity …
Green Blues: Biofuels add to Global Warming
Koert van MensvoortIt is official: the Green Blues has begun. Almost all bio-fuels used today cause more greenhouse gas emissions than conventional fuels if the full emissions costs of producing …
Green Roofs for Living
Arnoud van den HeuvelThis impression shows the ambitions of the city of Rotterdam for the coming decade. The city is supposed to have an image problem concerning its greenlife; as a big industrial …
Oil Price Threatens Biofuel Firms
Dr NaturalEconomy is ecology? Technology Review writes the price of oil has dipped to levels that could be far too low for many advanced-biofuel startups to succeed, especially those that …
Smart Forests - EWAN
Arnoud van den HeuvelAt Massachusetts Institute of Technology , Christopher Love and colleagues are working to find out whether energy from trees can be used to prevent forest fires. A sensor system …
A Society of Simulations
Koert van MensvoortAn interviewer once asked Pablo Picasso why he paints such strange pictures instead of painting things the way they are. Picasso asks the man what he means. The man then takes out …
A.T.R.E.E.M.
Arnoud van den HeuvelMeet A.T.R.E.E.M. (acronym for Automated Tree-Rental for Emission Encaging Machine), a device that compares daily activities, energy and products to the growth of a tree. "From an …
Cyborg Insects
Koert van MensvoortScientists at the University of California created a neural implant for a beetle that gives them wireless control over the insect. Electrical signals delivered via the electrodes …
Ecology – A New Opium for the Masses
Marxist philosopher Slavoj Žižek discusses the 'naturalization' of capitalism and how ecology became a new field of capitalist investment. He also argues that the ultimate …
Economy, as Seen From Space
Koert van MensvoortReliable data on economic growth is hard to come by in many parts of the world, especially in developing countries. Yet according to scientists, outer space offers a new …
Fresh from the Pharm
Gordon TiemstraWill we in the future still buy several needs according food in shops, or will we grow M&M’s ourselves? There is a lot happening on in the field of food technology , think for …
Growing a nano forrest
Koert van MensvoortJohn Hart, assistant professor of mechanical engineering at the University of Michigan, is inventing techniques for growing carefully structured forests of high-quality carbon …
Growth economy hits the ceiling?
Koert van MensvoortWe have lived for 200 years in a growth economy . That's more than a lifetime, so it is no surprise people tend to think of economy as infinitely growing. Herman Daly , who …
LHC – How physics becomes metaphysics
Koert van MensvoortLittle over a week after the Large Hadron Collider (LHC) became operational it broke down. As the world's largest particle accelerator isn't working, c omputer simulations are the …
Orthorexia Nervosa: the "healthy" eating disorder
Koert van MensvoortFollowing anorexia nervosa (under eating) and bulimia nervosa (overeating and compensating), orthorexia nervosa (obsessively healthy eating) is the latest eating disorder in the …
Pollution trading – savior or scam?
Koert van MensvoortWhile most people are still prudently changing light bulbs and recycling coffee cups to fight global warming – or at least their gnawing conscience – policy-makers have long moved …
The Next Hacking Frontier: Your Brain
Dr NaturalWiredScience writes: Hackers who commandeer your computer are bad enough. Now scientists worry that someday, they’ll try to take over your brain. In the past year, researchers …
The World Without Technology
Kevin KellyI remember the smoke the most. That pungent smell permeating the camps of tribal people. Everything they touch is infused with the lingering perfume of smoke – their food, …
The World's first Refrigerated Beach
Koert van MensvoortConspicuous consumption in the overdrive: The world's first refrigerated beach is to be built at a luxury hotel in the Dubai (aka the new Las Vegas) so the tourists don't burn …
Botnet Storm
Koert van MensvoortNo, this is not some solar system far, far away. Closer than you think, this is is a visualization of a botnet storm . For all you know this malicious virus, or one of its …
Go forth, Buy a Smartphone and Reproduce Thyself
Hendrik-Jan GrievinkIt took some years of evolution to turn sex (between different sexes) from a stricly functional activity attuned to reproduction, into the recreational activity it is primarily …
Grapple – a Grape flavored Apple
Koert van MensvoortThey say “An apple a day keeps the doctor away”, but now we wonder what this keeps away, the Grapple , a hyperfruit that "Grunches like an Apple. Tastes like a Grape." The …
Infobesity
Arnoud van den HeuvelCould this 2.0-bird be suffering from Infobesity ? Then it must be the result of excessive infocalorie consumption. Following people and news-sources on microblogservices like …
Join the Designers & Artists 4 Genomics Award
Koert van MensvoortSo, you are well aware that biotech will drive our evolution , you took the crash course on synthetic genomics , you've got your map of the DNA world in your backpack and are now …
Join the Synthetic Aesthetics project
Koert van MensvoortSo, you are aware biotech will drive our evolution , you took the crash course on synthetic genomics , you've got your map of the DNA world in your backpack and are now eager to …
Keep it cool with the Bio-Robot Fridge
Koert van MensvoortThe Bio Robot fridge is a speculative product that uses a non sticky, odourless gel to envelope stored food as individual pods. The idea is that the gel cools by absorbing heat …
Nano Supermarket – Jury Report
Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …
Natural-Born Junkies
Orestis TsinalisHippopotamus: a 2,5cm-long tablet-shaped nonliving chewable animal, member of a multi-species flock known as the Animal Parade, which tastes like fruit and is found in little pill …
Nature Preservation: The Literal Version
Minke Kampman* warning: high doses of irony detected in this article * Method #01: Canning Promotional gift 'Nature in a can' complete with soil and bean plant seeds (from DKNY , 2010). Method …
Nomadic Plants
Koert van MensvoortNomadic Plants are a species assembled from a group of robotic-electronic-biological organisms living in symbiosis in order to survive in habitats affected by human activity. The …
Oil Diet: Recipes for Disaster
Arnoud van den HeuvelDo you know how much oil you use per day? Neither did director John Webster. In 2005 he decided to make a documentary about oil from his own families perspective. How would it be …
The Buttons
Koert van MensvoortNowadays buttons are completely mundane and natural objects in our environment. You find them on phones, alarm clocks, keyboards, elevators, dishwashers and of course on the …
Anthropomorphobia
Koert van MensvoortAre you familiar with the affliction? Anthropomorphobia is the fear of recognizing human characteristics in non-human objects. The term is a hybrid of two Greek-derived words: …
City Planning with Bright Bacteria
Allison GuyRenegade architect and futurist Rachel Armstrong has proposed that our cities, currently constructed of dead trees, baked mud, and refined ore, need to be coated in a layer of …
Disgusting Switches
Koert van MensvoortIf a light switch would be hairy or snotty nobody would want to turn on the light anymore, which is exactly why designer Katrin Baumgarten created some of the most one nauseating …
Get Thee Up into a Fake Mountain
Allison GuyIf you felt like building a 2,000 meter mountain in the Netherlands, which features would you like to add? Journalist and accidental landscape visionary Thijs Zonneveld wants to …
Humane Technology #2: Revive Human Intuitions
Allison GuyOur second principle: Humane technology revives human intuitions, in particular those we might have forgotten about. 'Conventional' technology aims to overcome our hominid …
Incredibly Shrinking Humanity
Allison GuyArne Hendricks thinks we can solve the ecological crisis by shrinking every human on earth to 50cm tall: http://bit.ly/sxxNr1 #powershow
![Visual of Manko & Life [#8]](https://nextnature.net/media/pages/magazine/story/2011/manko-life-8/f762250e48-1602632753/manco-8-868x486.jpg)
Manko & Life [#8]
Aston RevolaManko sighed. Nada: 'Did you like it?' Manko: 'I have to admit that if this is the starter, I'm not sure I'll survive the main course.' Everyone at the table laughed. Manko: 'Let …
Parks & Planes
Natalie DixonAlong with a library and museum, Amsterdam's Schiphol Airport recently added a park to its list of attractions. Officially opened by Princess Irene, the first Airport Park in the …
Should we clone Neanderthals?
Zach ZorichIf Neanderthals ever walk the earth again, the primordial ooze from which they will rise is an emulsion of oil, water, and DNA capture beads engineered in the laboratory of 454 …
Streetlight Trees
Marco van BeersWe all know the cellphone masts disguised as trees , created in an attempt to blend technology within the 'natural' landscape. Now Taiwanese scientists have created trees that …
Tattoo 2.0
Marco van BeersAs a child you probably had one of those temporary tattoos that come packed with over-sweetened chewing gum. It was a nice decoration, and a way to stand out. Recently researchers …
The Incredible Shrinking Man
Lisa van der VoortIt has been a trend for people to grow taller and taller during the evolution. When people get taller, they will need more energy, food and space. Since the human population is …
The Sound of the Blue Canary
Berry EggenBlue is a beautiful color, but its sound is simply irresistible. It is the song of the unhappy and the depressed. It is a sound that touches people. It was also the sound of a …
We Domesticated Ourselves
Allison GuyOur bodies are maps of our ancestor's social lives. We evolved, physically and behaviorally, in incredibly complex social groups. Such intense sociability may have favored the …
Algae in the Supermarket
JenniferAs mentioned earlier , the world seems obsessed with algae. Not limited to producing light or energy , algae has also found its way to our plate as a new vegetable, and maybe …
Antifreeze from Fish Blood Keeps Low-Fat Ice Cream Rich and Creamy
Allison GuyFat is what makes ice cream taste rich and creamy. It's called ice cream, after all, not ice skim milk. So how have some manufacturers managed to make reduced fat ice cream that …
Arne Hendriks – Incredible Shrinking Man
Koert van MensvoortArtist Arne Hendriks explores the possibilities and implications of downsizing the human species to better fit the earth.
Artificial Islands for a Tsunami-Proof Japan
Allison GuyKeiichiro Sako of Sako Architects has proposed constructing giant, drum-shaped islands on dry land as a means to protect residents of Tohoku from future tsunamis. The elevated …
Bacteria "R" Us
Rachel ArmstrongThere is a domain of creatures that diffusively encircles an entire planet. There are so many of them that they occupy every conceivable ecological niche. Yet, despite their …
Better Than Nature?
Rachel ArmstrongAt the turn of the millennium, miniaturized canines acquired the cherished status of living, designer handbag ornaments. These teeny tiny photogenic doggies, which had been …
Four Objections to Lab-Grown Meat
Allison GuyIn vitro meat has been billed as a way to end animal suffering , put a stop to global warming , and solve the world's insatiable demand for animal protein. There's no doubt that …
Hybrid Hummer
Koert van MensvoortThere is something lustrous about a hummer pulled by horses. Peculiar image of the week.
Thijs Zonneveld – Let's build a Mountain
Koert van Mensvoort“God created the world, except for the Netherlands. That the Dutch created themselves” , Voltaire remarked in the eighteenth century already to describe the overly cultivated …
Little Green Cows
Rachel ArmstrongThe world is alight with algae fever. In this age of deep ecological design aspirations, the range of speculative design projects based on algae technology is growing. Algae are …
NANO Supermarket Unveils New Products
NextNature.netFrom sleek fashion to life-saving medicines. During the forthcoming Dutch Design Week , our lustrous NANO Supermarket debuts a new line of speculative nano products that might hit …
Nature Ludens: The Natural World at Play
Rachel ArmstrongAn ingenious Russian crow that used a lid as a snowboard to slide down a snowy roof persuaded millions of YouTube viewers that animals are not merely beasts of burden – they also …
The Ecological Human
Rachel ArmstrongThe nature of humanity in the twenty-first century is, according to sociologist Steve Fuller, a ‘bipolar disorder’ beset with dualisms of identification such as divine/animal, …
“Soccket” Ball Generates Free Electricity
Alessia AndreottiIt looks like a normal soccer ball, but Soccket has a secret: a hole for a charging cable. Designed by two Harvard students, the ball has a pendulum-like mechanism inside that …
Andras Forgacs on Victimless Leather
Koert van MensvoortAndras Forgacs argues that bioengineering meat and leather is a civilized way to move beyond slaughtering animals for hamburgers and handbags.
Cow Poower! Bacteria Turn Poo into Fuel
Silvia CelibertiFarmers in the US are producing fuel and high-quality fertilizer from their cows' manure.
Did Monogamy Make Us Human?
Allison GuyPair-bonding sets humans apart from our relatives. But where did it come from?
From Eco-Apartheid to Earth Democracy
Vandana ShivaDo humans exist merely to make money and use resources? Vandana Shiva believes humans have a higher purpose.
Get Ready for the Arctic to Bloom
Allison GuyIn the warming Arctic, an area the size of the US is now covered in vegetation.
Let's Build a Garden on Mars
Koert van MensvoortOne would need a gardening robot, fitted plant species and some kind of dome structure for the plants to grow in.
Why Meat Grown in Labs is the Next Logical Step for Food Production
Avy RoyLab grown meat is part of the trajectory that agricultural technology is already following.
The Holy Grail of Immortality
Casper JacobsInjecting mice with telomerase enables them to live 24% longer than the average mouse.
Toss the Brita: Bacteria Can Filter Antibiotics from Water
Fan ChenFilter and recover antibiotics from drinking water using only bacteria, water and sunlight.
Totem Animals for the Anthropocene
Ted HeistmanInvasive species become the animal symbols for a man-made world.
World's First In Vitro Hamburger Arrives
Allison GuyBreak out the ketchup: Mark Post has grown the world's first entirely artificial burger from cultured beef cells.
You Can Never Go Back To Nature
Annalee NewitzOne of the arguments that environmentalists use against factory farming and burning fossil fuels is that these activities are "unnatural" or that they "go against nature." But …
A Net will Collect Debris from Outer Space
Julia WeberJAXA developes a net that could collect debris from outer space.
Electricity From Plants
Lotte BiesheuvelA new technology enables us to produce electricity from living plants at practically every site where plants can grow.
Glow in the Dark Trees
Lotte BiesheuvelDaan Roosegaarde is exploring possibilities to replace streetlights with luminous trees.
Growing the Future of Meat
Christina AgapakisOutside of the limits imposed by the edges of an animal’s body, the cells can reproduce and multiply until they exhaust the nutrients and space provided, filling petri dishes and vats to grow the future of meat.
In Vitro Meat: Animal Liberation?
NextNature.netMany people welcome in vitro meat because of what it may mean for animals. Even though they often find the idea strange, the promise for animals is widely felt as a source of hope.
Join the Bio Art & Design Awards
Koert van MensvoortSo, you are well aware that biotech will drive our evolution , you took the crash course on synthetic genomics , you’ve got your map of the DNA world in your backpack and are now …
Learning Circuits While Playing With Clay
Robin BergmanKids learn the basics of electric circuits while playing with clay.
Monster Machine Swallows Tree in 15 Sec
Koert van Mensvoort15 seconds, that is the time it takes the mulcher monster to consume a 9 meter-tall, mature spruce – starting at the top, landing at the bottom.
Self-Assembling Fungus Tower
Alessia AndreottiHy-Fi, a structure built from a combination of corn husks and fungus.
Super Computer Chips
Robin BergmanIndium gallium arsenide couldbe the material of the new super computer chips of the future.
The Anthropocene Explosion
Koert van MensvoortWe have entered the Anthropocene epoch, in which humanity and its instrumentalities are the most potent and influential geological force.
A Tiny Trackpad That Fits on Your Nail
Yunus Emre DuyarResearchers from the Massachusetts Institute of Technology have developed a tiny wireless trackpad that could easily fit on your finger nail.
Bio Art & Design Awards 2015
Koert van MensvoortIf we are going to mutate the made & the born, let us at least do this creatively.
First Bionic Rose with Electronic Circuits
Margherita OlivoFor the first time, researchers at the University of Linkoping , Sweden, have succeeded in establishing organic circuits within living plants. They combined electronics with the …
Interview: Nadine Bongaerts, Synthetic Biologist Bridging Science with Society
NextNature.netWe recently talk to Nadine Bongaerts about the role and impact of synthetic biology, the gap between biosciences and society and the importance of communication to overcome the fear of new technologies.
Intimate Technology: the Battle for Our Body and Behaviour
Rinie van EstTechnology is nestling itself within us and between us, has knowledge about us and can act just like us.
Manta Ray Floating City
Alessia AndreottiFrench visionary architect Jacques Rougerie designed a utopian floating city shaped like a manta ray.
MIT Lets Robot Cheetah Off Leash
Hessel HoogerhuisRobot Cheetah has grown up! Scientists at MIT's Biometrics Robotics Lab have now trained their robo-feline Cheetah to detect obstacles and jump over hurdles as it runs, making it …
NNN Movement & the First ECO Coin
Alessia AndreottiWe officially launched the Next Nature Movement in The Netherlands. To seal the beginning of the Next Nature Movement, director Koert van Mensvoort donated the first symbolic ECO coin.
See Through the Skin with Your Smartphone
Wei Lun WangIn the near future he ability to see through things won’t be a dream anymore with this infrared smartphone camera.
Seeing the Sun Through Data
Adriene LillyThe Smithsonian’s National Air and Space museum has taken the sun observation to the next level with a giant public display of images and data that show the sun in hyper-real detail.
The Risk of Technological Unemployment
Daniel FragaStephen Hawking gives his opinion on what technological unemployment, aka machines taking over our jobs, can represent for future human societies.
The Designer who Grows Furniture
Hessel HoogerhuisGavin Munro is creating a farm where planted trees can be grown around braces and harvested as fully formed chairs, sculptures, lamps, and tables.
The Emergence of 4D Printing
João Paulo Miranda LammogliaAn inspiring TED talk by computational architect Skylar Tibbits about 4D printing, where the fourth dimension is time.
Agriculture Isn’t as Green as You Think
Megan Ray NicholsAgriculture today isn’t where it needs to be. Here’s how farmers are taking the next step for better agriculture tomorrow
Edible Battery for Ingestible Devices
Ruben BaartResearchers at Carnegie Mellon University are developing edible batteries to power ingestible medical devices for diagnosing and treating disease.
The Enlightenment Is Dead, Long Live the Entanglement
Danny HillisWe humans are changing. We have become so intertwined with what we have created that we are no longer separate from it. We have outgrown the distinction between the natural and the artificial. We are what we make.
Insects are helping us develop the future of hearing aids
Rob MalkinThe human ear is a miracle of mechanical evolution. It allows us to hear an astonishing range of sounds and to communicate and navigate in the world. It’s also easy to damage and …
Luminous Bike Lane Opened in Poland
Monika KozubThe first self-sufficient luminous bike lane opened last week in Poland.
Meet the Weather Drone
NextNature.netThe Weather Drone controls the weather, it makes sure the sun will shine on your birthday, or that the rain will fall during a period of drought.
An Edible Drone for Humanitarian Aid
Ruben BaartNigel Gifford is developing a drone that will be relatively inexpensive, disposable and edible.
This Robotic Stingray is Alive
Ruben BaartBy way of reverse engineering and taking heart cells from a rat, researchers at Harvard University have designed a miniature robotic stingray that is alive.
Meeting the Future at TodaysArt
Monika KozubLast week The Hague hosted a festival dedicated to contemporary experiments in music, art and digital culture.
Welcome to the City Made of Bone
Monika KozubOur cities are made out of steel and concrete. What if we replace them with wood and bone?
1999 - Ectogenesis Enters The Matrix
Elle Zhan WeiThe movie The Matrix brought ectogenesis to the public eye.
Animal Free Cow Milk
Elle Zhan WeiA San Francisco-based start up discovered a way to "brew" milk that has zero hormones, antibiotics, steroid or lactose inside, and a longer shelf-life.
Animal Tsunami Alerts from Space
Alejandro AlvarezGlobal data about animal movements are indispensable in our today international networked world to understand how to safe human health and wildlife simultaneously.
Architects, You Better Design Cars!
Alejandro AlvarezHyundai envisions a future where your smart home is your driverless car, and vice versa.
A Whole Forest on a Surface Area of 3.5m2
Julie ReindlUsing moss cultures, the "CityTree" captures and filters toxic pollutants from the air, with the same environmental impact of 275 trees.
ECO Coin Award 2017 Nominations Open
NextNature.netThe nominations for the ECO coin Award 2017 are now officially open. Let us know who you think deserves to earn the award.
ECO Coin First Trial at DGTL 2017
NextNature.netWe had a wonderful first run of the ECO Coin during DGTL festival in Amsterdam.
ECO Coin Goes to DGTL Festival 2017
NextNature.netThis year the ECO coin will run its first community experiment with our partners at DGTL festival. Come and earn your first ECO!
ECO Coin Award Interviews: Sandra Rey
Jack CaulfieldWe asked Sandra Rey, our third ECO Coin Award nominee, about her company Glowee and her hopes for illuminating the future in a more sustainable way.
ECO Coin Lab at Welcome to the Village
NextNature.netLast weekend the ECO coin ran its second living lab at Welcome to the Village festival. We wanted to experiment with making our new sustainable currency more social and test our new ECO coin payment system.
Fellow Day 2017: Next Habitat
Ruben BaartLast week, our NNN fellows gathered to discuss the Next Habitat; how will we work in the future? And how does this affect our personal lives?
Flying Car Modular Transport System
Elle Zhan WeiAirbus and Italdesign unveil modular urban land and air transport system.
From Industry 1.0 to Industry 4.0
Megan Ray NicholsWarehouse management practices and processes evolved with the time, but they’ll need to maintain their adaptability to accommodate Industry 4.0.
An afternoon with Josh Tetrick: The man who wants to bring in vitro meat to the market by 2018
Ruben BaartMeet Josh Tetrick, entrepreneur who wants to reinvent the food industry and plans to launch lab-grown meat on the market by the end of 2018.
Looking into the Artificial Eye
Elle Zhan WeiSensor specialists recently developed a sensor that mimics the mammalian eye.
Next Nature Gift Guide 2017
NextNature.netThe gift giving season is once again upon us and to help out those who are struggling to find that perfect gift for that special someone we have brought together a collection of Next Nature inspired gifts.
Recharge! Sun for Your Brain Cells
Julie ReindlA gadget called HumanCharger promises "the sun in your pocket" to give you energy, by beaming light through your ears.
From Shopping Center to Urban Farm
Alessia AndreottiRooftop farm takes over Israel’s oldest mall to grow thousands of organic vegetables.
Skyscraper Hanging from the Sky
Elle Zhan WeiWhat if we rethink the system and instead of building from earth to sky, we do it the other way around?
Transformative Appetite: Shape-Shifting Pasta
NextNature.netMIT Media Lab developed pasta programmed on a computer.
The Water-Cleaning Bike
Elle Zhan WeiHow about a peddling ride accompanied by the sound of babbling water, with the awareness that what you are leaving behind is nothing else but clean water?
World’s First Lab-Grown Chicken Is Here
Elle Zhan WeiMemphis Meats reveals world’s first lab-grown chicken.
How AI and genomics will impact the future of making babies
Vanessa Bates RamirezAs if stand-alone technologies weren’t advancing fast enough, we’re in age where we must study the intersection points of these technologies. How is what’s happening in robotics …
This artwork lets trees tell the story of climate change
Linda ValentaIn our ongoing battle against climate change, it's hard to transcend from our human position and ‘think’ like nature. Given, nature doesn't think the way humans do, but it does …
Here’s how the Dutch are embracing blockchain in the polder
Coen van de VenSmiling broadly and rattling with enthusiasm, the 33-year-old Rylana Doesburg shows off a QR-code on her phone: an angular pattern of black and white squares. “Thanks to this …
Adding a new dimension to marine restoration: 3D printing coral reefs
David KlingesThe local fishermen looked on skeptically. From the deck of a small motorboat, scuba divers grabbed odd chunks of ceramic – which could be described as rocky brains stuck on …
The return of direct democracy: Introducing a digital agora to the crypto-world
Koen WeselIn Ancient Greece the people were part of a direct-democracy, this means that they would directly vote for policies and laws. Nowadays, it seems as though this horizontal approach …
Your Next Nature guide to Dutch Design Week 2018
Meike SchipperOver time, our bodies, our food and our environment have become more and more subject to design. As designers, we hold the responsibility and have the unique chance to envision …
Interview: Huub Ehlhardt on the evolution of products
Kelly van Gemert"To understand why a product is the way it is today, you need to learn about its evolutionary background." Meet Huub Ehlhardt, an engineer with a PhD in product design . Huub …
Should lab-grown meat be labelled as meat when it's available for sale?
Hope JohnsonAustralian regulators will soon be faced with a challenge: can animal flesh produced in a lab be called meat? Amid reports that lab-grown meat could be on sale this year, the US …
Scientists accidentally create mutant enzyme that eats plastic bottles
Damian CarringtonScientists have created a mutant enzyme that breaks down plastic drinks bottles – by accident. The breakthrough could help solve the global plastic pollution crisis by enabling …
Next Nature Gift Guide 2018
The season of giving has come and to make sure you can find the perfect gift for your loved ones we have brought together a collection of Next Nature inspired goodies. Whether you …
On the origin of the e-bike
Huub EhlhardtThe oldest known serious candidate forerunner for the bicycle is the ‘running machine’ built by the German Baron Karl von Drais. His two-wheeled machine became known as the …
ReTuna: the Shopping Mall Selling Nothing but Recycled Products
Jack CaulfieldA Swedish shopping center is bucking the trend of mindless consumption. At the ReTuna Återbruksgalleria every product is made of recycled materials.
The Story of Money: Bits
NextNature.netThe story of money: an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. The final episode: bits.
How an app is helping restaurants cut food waste
Meike SchipperGlobally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …
Air pollution may be making us less intelligent
Barbara MaherNot only is air pollution bad for our lungs and heart , it turns out it could actually be making us less intelligent, too. A recent study found that in elderly people living in …
Next Nature is hiring an army of bots
Next Nature DevAs we showed with HUBOT , we can use new technologies and robotics to make our work more enjoyable, interesting and humane. Aside from our speculative jobs, a lot of robotic …
6 designers changing the future of fashion
Meike SchipperWe live in a world of fast or disposable fashion. This industry is increasingly impacting the environment due to the use of toxic chemicals, water and energy consumption, heavy …
5 must-see exhibitions before the end of the year
Ruben BaartA large-scale asian food market serving in vitro meat, a transatlantic expo on the future of nature and a travelling exhibition that explores our relationship with AI. These five …
Discover the art of the living at Centre Pompidou
Ruben BaartGo forward to nature at the La Fabrique du Vivant (the Factory of Life), the newly opened exhibition at the Centre Pompidou in Paris. Exhibiting the recent works of fifty …
NATURE is an exhibition where biology and design meet
Ruben BaartCube Design Museum in Kerkrade and Cooper Hewitt in New York present the comprehensive exhibition NATURE - in which internationally renowned designers, artists and inventors …
The Next Nature gift guide 2019
Next Nature DevWhether you're in need of a holiday gift for your techie spouse or tech-adverse grandpa, the truth is, your loved ones deserve better than a generic gift card. Now we understand …
Recap of the Next Nature book launch
Next Nature DevThe new Next Nature book is here ! Next Nature fellows, ambassadors, members and newly interested people came together on the 4th of June to celebrate the book launch with a …
The Coming World: ecology as the new politics
Ruben BaartIn science fiction and popular science, 2030 is often suggested as the year in which our planet will run out of oil. Similarly, 2100 will be the year that, according to …
Smart cities could give the visually impaired a new outlook on urban life
Drishty SobnathTravelling to work, meeting friends for a catch up or just doing some shopping are often taken for granted by people with no known disabilities. For the visually impaired, these …
Who should win the ECO Coin Award 2019?
Next Nature DevEach year we celebrate ecological heroes as part of our ECO Coin Award and this year is no different. Have you seen an inspiring person who is making the world a more …
A path to humane technology
Koert van MensvoortIn 1486, six years before Columbus dropped anchor in the New World, the 23-year-old Italian nobleman Giovanni Pico della Mirandola penned a passionate discourse on the unique …
Build an organisation that lasts by creating a superorganism
Tamsin Woolley-BarkerFor the past 25 years, I’ve studied everything from baboon cooperation in Ethiopia and orca whale innovation in the Bering Sea, to the Argentine ant invasion in my kitchen, and my …
How a 6.000-year-old fruit fly gave us cheese
John MorrisseyHistorians often trace the dawn of human civilisation back 10,000 years, when Neolithic tribes first settled and began farming in the Fertile Crescent, which stretches through …
How future fashion could help us cope with isolation
Ruben BaartToday we cannot meet, touch or hug our loved ones. And while we all like the feeling of the touch of another human being, physical contact does not just feel nice, it is crucial …
Matilde Boelhouwer wants to make urban environments flower again
Ruben BaartMatilde Boelhouwer is a designer whose work speculates between art, design, science, biology and food. Matilde shapes this obligation into a studio which mainly focuses on the …
Suzanne Lee wants to live in a world that uses only sustainable materials
Ruben BaartBiotechnology is nearly as old as humanity itself. The food you eat and the pets you love? You can thank our ancestors for kickstarting the agricultural revolution, using …
Netflix is the new symbol of quarantine
Claire OuwejanSince the 16th of March 2020, the government of the Netherlands applied new measures to stop the spread of the novel coronavirus (COVID-19). Schools, cafes, restaurants and sport …
Next Generation: illustrating the remains of the anthropocene with Louise Silfversparre
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
The Coronation
Charles EisensteinFor years, normality has been stretched nearly to its breaking point, a rope pulled tighter and tighter, waiting for a nip of the black swan’s beak to snap it in two. Now that the …
The Invention of Morel is a techno-lovestory from the future
Ruben BaartOctavio Paz says calls The Invention of Morel , “ without exaggeration… a perfect novel. ” According to Borges, “ to classify [it] as perfect is neither an …
Towards a global society as a superorganism
Ruben BaartToday we hold the ability to gather a lot of knowledge, thanks to science. We are able to watch, analyze, manipulate and change matter to the nano-level. This makes it tempting to …
In conversation with cyborg musician Kai Landre
Ruben BaartWhat does the merge of bodies and technology mean for the human? For cyborg Kai Landre, cybernetic extensions become body parts and not technology. Kai began his transition to a …
How can Big History help us think about the future?
Noriko Wynn'Big History' is a multidisciplinary study that seeks to put the human story into the context of a 13.8 billion-year story from the Big Bang to now.
Blind woman sees with new implant and plays video game sent straight to her brain
Ruben BaartIt’s been over a decade since artificial retinas first began helping the blind see. But for many people, whose blindness originates beyond the retina, the technology falls short. …
Check your technoprivilege!
Hendrik-Jan GrievinkTechnology is not neutral; the same tech might empower some and disempower others. It is time to check our Technoprivilege, argues author Hendrik-Jan Grievink.
Cyborg mythologies #3: in god we trust, all others bring data
MaithriThis is #3 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …
Bio textiles: meet three designers reimagining materials using biotechnology
Alexandra KisielewskiThe world needs interdisciplinary creators who are designing not just for humans, but for the rest of the living planet. To foster this thinking, Biodesign Challenge (BDC) pairs …
Dune explores the geopolitics behind resource extraction
Oli MouldDune offers a useful allegorical narrative of the “scramble for Africa”, which saw European empires carve up the continent into colonized powers.
How a mantis shrimp can one day help build self-growing roads
MaithriDon’t get fooled by the colourful, unsuspecting demeanour and size of the mantis shrimp. Known as “death incarnate” to its prey on the seafloor, the crustacean hides two …
Max Liboiron: pollution is colonialism
Ruben BaartWe now live in a world where plastics are becoming a part of our marine ecosystems. As a result, we strive hard to clean the plastics from our oceans. Dr. Max Liboiron ( Michif …
Meet Kaia the CO2 filtering lamp
Kelly van GemertDid you know that we owe every second breath we take to the algae in the sea? And that minerals have been absorbing CO2 for billions of years while converting it into important …
Join the Next Nature Talkshow on biodesign!
Next Nature DevA living lamp that you need to feed, a tapestry made of animal waste streams and tableware made from algae. Welcome to the wonderful world of biodesign.
The Next Nature Magazine is here!
Next Nature DevIt’s our pleasure to announce the first issue of the Next Nature Magazine. Indeed, a good old fashioned magazine. Next Nature Magazine presents 176 pages of thought-provoking …
When will the first baby be born in space?
Chris ImpeyWhen the first baby is born off-Earth, it will be a milestone as momentous as humanity’s first steps out of Africa . Such a birth would mark the beginning of a multi–planet …
Why urban gardens are crucial for conserving bees and butterflies
Ruben BaartAs humans have industrialised farming to feed a growing global population, pollinators – animals vital for plant reproduction – have seen their food supply decline. In the UK, …
Chloé Rutzerveld designs the food of tomorrow
Eleni MaragkouYou are in for a surprise when you look at food and concept designer Chloé Rutzerveld 's portfolio. It is hard to believe that somebody so young - she is just 25 - has already …
The Embassy of Health is designing a chronically healthy society
Eloise MaraisHow will we stay healthy in the future? Can we utilize the power of design to move towards a more healthy society?
Growing artificial muscles
Marit BeerseA team of researchers from Freiburg University has developed an artificial muscle that may result in improvements in medicine, prosthetics, and implants.
Time gets bendy in Disney Pixar's new film
Marit BeerseSpoiler alert: this article explains a key plot point, but we don’t give away anything you won’t see in trailers. At the beginning of the new Disney Pixar film, Lightyear, Buzz …
Personalise your gut health with Microbiota To Go
Ruben BaartIn the supermarket of the future, part of the Embassy of Food at Dutch Design Week, designer Merle Bergers will present her project Microbiota To Go.
Next Generation: Demonstrating non-human narratives with Lindsey Bundel
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Generation: Wandering through the post wilderness with Melissa Schwarz
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Generation: Changing the oceans chemistry with Santa Ramaherison
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
The carbon footprint of space tourism
Eloise MaraisThe commercial race to get tourists to space is heating up between Virgin Group founder Sir Richard Branson and former Amazon CEO Jeff Bezos. On Sunday 11 July, Branson ascended …
Using the intelligence of plants to battle climate change
Marit BeerseLiving Carbon enhances natural traits in plants as a solution for stabilizing the climate by increasing the efficiency of the photosynthesis process.
Whoops! Our sustainability efforts are warming the oceans
Koert van MensvoortCleaning up ships' pollution is making the ocean warmer than expected. Less pollution means less cooling clouds, heating up the Atlantic.
Meat the future: the Netherlands might soon become a global hub for in vitro meat
Lucas ZarzosoRemember when we created a little petition back in 2018 in the hope to legalise the tasting of in vitro meat? About 4000 of you agreed with us and signed it. If you were one of …
We can now grow insulin from lettuce
Selin KirIn a ground-breaking discovery, researchers at the University of Pennsylvania have achieved to produce insulin out of lettuce. There's no need for needles and injections anymore, …
Cleaning water with magnets
Kelly van GemertWhat if we could clean our water with magnets? Wageningen University & Research, introduces the Magnetic Adsorption-Desorption (MAD) project.
Obese mice are losing weight without breaking a sweat
Kelly van GemertBye-bye gym membership, hello losing pounds. Scientists have found a new drug that helped obese mice lose weight.
Using bacteria to create self-fired and biologically glazed ceramics
Kelly van GemertEmbracing nature's ingenuity, designer Nicole Chrysikou harnesses the power of bacteria for her pottery practices.
Browse the Catalog For The Post-Human
Veronica FanzioAugment your physiology. Enhance your prospects. From neuro-electronics, to robotic-prosthetics and mind-altering pharmaceuticals.
The Museum of Edible Earth
Kelly van GemertWe spoke with the Museum of Edible Earth, a travelling museum dedicated to the prosperous amount of soil samples.
Wild wild space
Veronica FanzioWhen Earth goes south, cowboys go all the way up. The Space Rush of 2020s has something to do with settler colonialism.
Future Festive Feast
Kelly van GemertAs the year is coming to a close, many of us are preparing our homes and dinner tables for a festive meal.
Meet the BAD Awards winners of 2023
Kelly van GemertThe annual Bio Art & Design (BAD) Award encourages new artists and designers to explore the world of bio art and design. Let's have a look at the three winning projects of this year.
Building the farm of tomorrow
Kelly van GemertSeven examples of how design will help us built the farm of tomorrow.
Next Nature is ancient
Ruben BaartUli Westphal's Seed Series is an ongoing attempt to document the seeds of all edible plants, one seed at a time.